Query (optional)   in Class  

GrainGenes Probe Report: ABG62

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG62  [ Marker Report ]
Locus
ABG62
ABG062
ABG062-6H
Synonym
SynonymHAR35_42532
External Databases
DDBJ
EMBL
GenBank
Type
Genomic
STS
PCR primers
GTTTTGTCATTTTCTGTTCA
GCATTTGTTCTAATTTCTCA
Sequence
L44078
ABG62
Source Species
Hordeum vulgare
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24