Query (optional)   in Class  

GrainGenes Probe Report: ABG64

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG64  [ Marker Report ]
Locus
ABG064
ABG64
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
GGCTGAATCATCCGCTCATA
GGGTATGCATGGACGTGGTC
Sequence
L44079
ABG64
Source Species
Hordeum vulgare
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24