Query (optional)   in Class  

GrainGenes Probe Report: AB_AM_100

[ Printable Version ]  [ Submit comment/correction ]

Probe
AB_AM_100
PCR primers
Forward 5'- TTTCATCTGAAACCCCTTGG
Reverse 5'- CCTACGCGAACCTTCTTCTG
Source Species
Avena sativa
Clone Authority
Jellen, Rick