Query (optional)   in Class  

GrainGenes Probe Report: AB_AM_219

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
AB_AM_219
Locus
AB_AM_219-295
Reference
ReferenceDumlupinar Z et al. (2016) The art of attrition: development of robust oat microsatellites Plant Breeding 135:323-334.
General Remarks
Insert contains motif = (ATC)10
PCR primers
Forward 5'- CACCACAACAAAGGCAGATG
Reverse 5'- ACATGCAGTTGGAGGAAAGG
Amplification Conditions
Anneal at 55 degrees C
Source Species
Avena sativa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.