Query (optional)   in Class  

GrainGenes Probe Report: AC11

[ Printable Version ]  [ Submit comment/correction ]

Probe
AC11  [ Marker Report ]
Locus
Xcnl7-1D
[ Show all 9 ]
PCR primers
CGAGAATAAGGGGATTGACAAC
CAGTGGCAGCTCCATCC
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24