Query (optional)   in Class  

GrainGenes Probe Report: AG24

[ Printable Version ]  [ Submit comment/correction ]

Probe
AG24  [ Marker Report ]
Locus
Xcnl6-2B
[ Show all 8 ]
Reference
ReferenceMa ZQ et al. (1996) Frequencies and sequence characteristics of di-, tri-, and tetranucleotide microsatellites in wheat. Genome 39:123-130.
General Remarks
Repeat sequences (TC)17C2(TC)6(C)2(TC)9
Product size 204 in Geneva PI505819
Type
PCR
SSR
PCR primers
GGACGAATGAAAAATTCCCAGG
GAGCGGTCTTCGGACTTTC
Amplification Conditions
Annealing temperature 50 C, 2.50 mM MgCl2
Source Species
Triticum aestivum
Clone Authority
Sorrells, Mark E.
Blake, Tom
Data Source
Sorrells, Mark E.95.09.13
Blake, Tom95.08.24