Query (optional)   in Class  

GrainGenes Probe Report: AG31

[ Printable Version ]  [ Submit comment/correction ]

Probe
AG31
Reference
ReferenceMa ZQ et al. (1996) Frequencies and sequence characteristics of di-, tri-, and tetranucleotide microsatellites in wheat. Genome 39:123-130.
General Remarks
Product size 236 in Geneva PI505819
Type
PCR
SSR
PCR primers
CACAAACCAACAATCCACCTAG
GTCGCACATAAGTGCCCTG
Amplification Conditions
Annealing temperature 59 C, 3.00 mM MgCl2
Source Species
Triticum aestivum
Clone Authority
Sorrells, Mark E.
Data Source
Sorrells, Mark E.95.09.13