Query (optional)   in Class  

GrainGenes Probe Report: AG49

Probe
AG49
Reference
ReferenceMa ZQ et al. (1996) Frequencies and sequence characteristics of di-, tri-, and tetranucleotide microsatellites in wheat. Genome 39:123-130.
General Remarks
Product size 173 in Geneva PI505819
Type
PCR
SSR
PCR primers
CCACGATGAGGAGGGAG
AGATAGAGAGGGGAAAATACC
Amplification Conditions
Annealing temperature 50 C, 1.50 mM MgCl2
Source Species
Triticum aestivum
Clone Authority
Sorrells, Mark E.
Data Source
Sorrells, Mark E.95.09.13