Query (optional)   in Class  

GrainGenes Probe Report: AWBMS22

[ Printable Version ]  [ Submit comment/correction ]

Probe
AWBMS22  [ Marker Report ]
Locus
AWBMS0022
AWBMS22
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceKarakousis A et al. (2003) A consensus map of barley integrating SSR, RFLP, and AFLP markers Australian Journal of Agricultural Research 54:1173-1185.
General Remarks
Adelaide Waite Barley Microsatellite
Type
PCR
SSR
PCR primers
CCACTTCAAAGGCTTCCACA
CCGGAGAGTTGCTAATCT
F 5' CAAAGGCTTCCACACA
R 5' CCGGAGAGTTGCTAATCT
Forward CCACTTCAAAGGCTTCCACA
Reverse CCGGAGAGTTGCTAATCT
Data Source
Langridge, Peter J.