Query (optional)   in Class  

GrainGenes Probe Report: AWBMS37

[ Printable Version ]  [ Submit comment/correction ]

Probe
AWBMS37  [ Marker Report ]
Locus
AWBMS37
Reference
ReferenceKarakousis A et al. (2003) A consensus map of barley integrating SSR, RFLP, and AFLP markers Australian Journal of Agricultural Research 54:1173-1185.
General Remarks
Adelaide Waite Barley Microsatellite
Type
PCR
SSR
PCR primers
F 5' GCAACAACGAGAATGATGAC
R 5' CGTCGCCGATGTAGTAGTT
Data Source
Langridge, Peter J.