Query (optional)   in Class  

GrainGenes Probe Report: AWBMS80

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
AWBMS80  [ Marker Report ]
Locus
AWBMS0080
AWBMS80
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceKarakousis A et al. (2003) A consensus map of barley integrating SSR, RFLP, and AFLP markers Australian Journal of Agricultural Research 54:1173-1185.
General Remarks
Adelaide Waite Barley Microsatellite
Type
PCR
SSR
PCR primers
F 5' GCTTTCAGCATCTCAACTGCG
R 5' TGTATGCCAGGAAAACGGAACC
GCTTTCAGCATCTCAACTGCG
TGTATGCCAGGAAAACGGAACC
Data Source
Langridge, Peter J.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.