Query (optional)   in Class  

GrainGenes Probe Report: AX-95248570_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
AX-95248570_KASP
Locus
AX-95248570
Reference
ReferenceNannuru VKR et al. (2022) Genetic architecture of fusarium head blight disease resistance and associated traits in Nordic spring wheat Theoretical and Applied Genetics 135:2247-2263.
Type
KASP
PCR primers
Forward 1 TGGGACTGGATGTGGTGAG
Forward 2 TGGGACTGGATGTGGTGAA
Common GCAAAGCAATAGGGCTAGGA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.