Query (optional)   in Class  

GrainGenes Probe Report: Alrk1A1

[ Printable Version ]  [ Submit comment/correction ]

Probe
Alrk1A1
Locus
ALrk1A1_A
ALrk1A1_B
ALrk1A1_C
ALrk1A1_D
ALrk1A1_E
Reference
ReferenceCheng DW et al. (2002) Genetic and physical mapping of Lrk10-like receptor kinase sequences in hexaploid oat (Avena sativa L.) Genome 45:100-109.
General Remarks
The F1/R1 primer pair amplifies region at the end of the extra-cellular domain
The F2/F2 primer pair amplifies the region inside the start codon of exon 3
Type
PCR
PCR primers
F1 (5' CCCGGGCAGAAGCACAGAAAGATGAGT 3')
R1 (5' GCCATAACCATGAGGGTCAGGCATGCA 3')
F2 (5' GCGTTCAGCTCACAAAGGGATAGAG 3')
R2 (5' GCCACCGTCAACAAAAGAGCAACA 3')
Source Species
Avena sativa