Query (optional)   in Class  

GrainGenes Probe Report: BA00502220_KASP

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BA00502220_KASP
Locus
AX-94472219
General Remarks
[ Hide all but 1 of 8 ]
SNP = C51G
SNP type = non-homoeologous
KASP primer type = chromosome_nonspecific
KASP product orientation = reverse
Tm of KASP primer A = 59.44
Tm of KASP primer B = 59.191
Tm of common KASP primer = 60.109
PCR product size = 51 bp
Type
KASP
PCR primers
KASP primer A 5' tggttacgtatgtgtgttggttG
KASP primer B 5' tggttacgtatgtgtgttggttC
KASP Common Primer 5' gtggacgtagatgcacagct
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.