Query (optional)   in Class  

GrainGenes Probe Report: BA00615315_KASP

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BA00615315_KASP
Locus
AX-95196508
General Remarks
SNP = C51G
[ Show all 8 ]
Type
KASP
PCR primers
KASP primer A 5' ggctagtgcaaccgtggatG
KASP primer B 5' ggctagtgcaaccgtggatC
KASP Common Primer 5' tgcctcgttgctaggaacaa
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.