GrainGenes Probe Report: BA00903264

GrainGenes Probe Report: BA00903264_KASP

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe

BA00903264_KASP

Locus

AX-95257360

General Remarks

[ Hide all but 1 of 8 ]

SNP = A51G

SNP type = homoeologous

KASP primer type = chromosome_nonspecific

KASP product orientation = reverse

Tm of KASP primer A = 59.649

Tm of KASP primer B = 60.669

Tm of common KASP primer = 59.749

PCR product size = 62 bp

Type

KASP

PCR primers

KASP primer A 5' gcgtcctgTccaacccaT

KASP primer B 5' gcgtcctgTccaacccaC

KASP Common Primer 5' ccacctctcaccatggacag

Source Species

Triticum aestivum


GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.