Query (optional)   in Class  

GrainGenes Probe Report: BAGY2CM61

[ Printable Version ]  [ Submit comment/correction ]

Probe
BAGY2CM61  [ Marker Report ]
Locus
BAGY2CM61h
[ Show all 23 ]
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 5' and 35 nucleotides internal to the LTR terminus
MseI primer (KeyGene code) = CTG (M61)
Type
PCR
STS
PCR primers
BAGY-2-C0589 5' TTCGACACTCTTACTTATCGAAAGG 3'
Mse1 primer M61 5' GATGAGTCCTGAGTAACTG 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4416
Source Species
Hordeum vulgare