Query (optional)   in Class  

GrainGenes Probe Report: BARC102

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BARC102
Locus
Xbarc102.2
[ Show all 12 ]
General Remarks
Contains motif : (TTA)20
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GGAGAGGACCTGCTAAAATCGAAGACA 3'
5' GCGTTTACGGATCAGTGTTGGAGA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211585
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.