Query (optional)   in Class  

GrainGenes Probe Report: BARC127

[ Printable Version ]  [ Submit comment/correction ]

Probe
BARC127  [ Marker Report ]
Locus
[ Hide all but 1 of 6 ]
Xbarc127-7A
Xbarc127
Xbarc127-6B
barc127
barc127-7A
barc127-6B
General Remarks
Contains motif : (CT)19
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' TGCATGCACTGTCCTTTGTATT 3'
5' AAGATGCGGGCTGTTTTCTA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211328
Source Species
Triticum aestivum
Data Source
Ward, Rick