Query (optional)   in Class  

GrainGenes Probe Report: BARC144

[ Printable Version ]  [ Submit comment/correction ]

Probe
BARC144  [ Marker Report ]
Locus
Xbarc144-5D
[ Show all 8 ]
General Remarks
Contains motif : (CT)15
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGTTTTAGGTGGACGACATAGATAGA 3'
5' GCGCCACGGGCATTTCTCATAC 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211627
Source Species
Triticum aestivum
Data Source
Ward, Rick