Query (optional)   in Class  

GrainGenes Probe Report: BARC173

[ Submit comment/correction ]

Probe
BARC173  [ Marker Report ]
Locus
Xbarc173-6D
[ Show all 7 ]
Reference
ReferenceOlson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Contains motif : (ATT)29(TAG)8(CAA)4
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GGGGATCCTTCAACAATAACA 3'
5' GCGAGATGGCATTTTTAAATAAAGAGAC 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211532
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.