Query (optional)   in Class  

GrainGenes Probe Report: BARC1

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
BARC1  [ Marker Report ]
Locus
Xbarc1-5A
Xbarc1
barc1
barc1-5A
General Remarks
Contains motif : (TAA)8
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGATGCTTTTGCCTTGTTTCAG 3'
5' GCGGCCCCTTTGACTCTTCATAG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211580
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.