Query (optional)   in Class  

GrainGenes Probe Report: BARE1-5M59

[ Printable Version ]  [ Submit comment/correction ]

Probe
BARE1-5M59  [ Marker Report ]
Locus
[ Hide all but 1 of 16 ]
BARE1-5M59i
BARE1-5M59h
BARE1-5M59c
BARE1-5M59l
BARE1-5M59a
BARE1-5M59e
BARE1-5M59p
BARE1-5M59j
BARE1-5M59g
BARE1-5M59f
BARE1-5M59m
BARE1-5M59d
BARE1-5M59b
BARE1-5M59n
BARE1-5M59o
BARE1-5M59q
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
General Remarks
Position of retroposon-based primer in the LTR = 5' terminus + A
MseI primer (KeyGene code) = CTA (M59)
Type
PCR
STS
PCR primers
BARE-1-5980 5' CTAGGGCATAATTCCAACAA 3'
Mse1 primer M59 5' GATGAGTCCTGAGTAACTA 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4419
Source Species
Hordeum vulgare