Query (optional)   in Class  

GrainGenes Probe Report: BCD276

[ Printable Version ]  [ Submit comment/correction ]

Probe
BCD276  [ Marker Report ]
Locus
BCD276
Xbcd276
Xbcd276-6B
Synonym
SynonymHAR35_15384
HAR35_2180
HAR35_2181
Reference
ReferenceHeun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
ReferenceTAG-submitted.
General Remarks
Lambda ZAP II library
Restriction Enzyme for CAPS marker is MwoI
Bar.LambZAPII [c]
Type
cDNA
PCR primers
5' ttgggccagttgttagtgaaggac 3'
5' caatttgcgtagccgatgataaca 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 63 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence
BE438689
BE438780
BCD276_WHE1A0061
BCD276_WHE1A0062
Polymorphism
Durums BCD276 EcoRI
Linkage Group
6L
Insert Enzyme
EcoRI
Source Species
Hordeum vulgare
Source Germplasm
Willis
Source Tissue
etiolated leaf
Insert Size
0.9
PCR size
0.9
Clone Vector
pBluSK
pBluSK-
Excision Enzyme
EcoRI
Vector PCR primers
M13forward
M13reverse
Vector Amplification
94 C for 78 sec, 50 C 78 sec, 72 C 120 sec, 25 times; 94 C for 78 sec, 50 C 78 sec, 72 C 5 min, 1 time
Antibiotic
Ampicillin
Clone Location
Sorrells, Mark E.
GrainGenes Probe Repository
Clone Authority
Sorrells, Mark E.
Data Source
Sorrells, Mark E.96.07
Niks, Rients E.2006.08
Marcel, Thierry C.2006.08
ATMI92.09