Query (optional)   in Class  

GrainGenes Probe Report: BE352587-B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE352587-B
Data at Wheat_SNP
BE352587-B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>C;T>A;T>G;C>A;T>G;A>C;G>C at 4;5;35;559;1549;1595;1596;1600
Reference sequence TTTCAAATTCTGCATCTGGCAATATCAAACATGTTTCGGTTGCAGATTTCTTTTAGGTTTCTTGTGTCCATTGCTTTGGTACTATGCAACTACTCTTTACTGCTGCAAGTACTACAATAGGGATCCCCGAGAGCGCCCCGGTCTTGCTGCCTCTGCCATTGCGGTAGGTTGTCCTTCACTGTAAATCCTGAACATGTTGCTATAATTAATGTAGCTTGAAAGAAAACAACTCATAGATGCAAAGTAGTGTAATAGATAAACCATATCTAGGTACAGAAAGCAAAAGAGTTTTCCTGTACAAAGTCATTTCTTAATGCATGTAAACCATCATGCAACCTGATAGCAGACGTGTTGATGGTTCTGCCACCATATTGATTCACAGATTGATTATTTTTGTAGTGAAGGTGTGTTTTAATCCCGTTTGCTCCATCCTTTTCTATGAAAATGCACATATGTGGAAATGAGCCCCATTTGTATATTTTCTATTTGGACAACGCTAACGCCCACACGTGTGGTGGGAGTCAAACCCGCCCACACGCCCTATAACATATAGACTACTCCATGTCACCGCATGCATGCATGTGGAAATCTTTTTGGATTTTCAGTTTTTAAAATGTTTTATCTTTTAAATGAAAAATCCGATTGAAGATCCGTTTTCATCATTAAATCCCTCGCGACGAGATCTTCAAAACTAGATATCATATCAATATATTTCAACGAATTTTTTTTTGGTTAAAAGTTGCCATGTCTATTGCACATGAATTGCCATGATGTTTACACTAAAGTTGCCATGTTATGTTTCAGCTATTTTTTCTATATTAAAAAGTAAATTTTGACATATTATAAAATGGAGAATTAAGAAACTAGACTTGCCATGCACTATAAACTAAAATTGCCATGATACATGCACTTAAAATTGCCATGGTTCATGCAAAAAAATATTTTCATGGTCAAAGTACTGGAATTGCCATCATCAGAAACTAAAATTGCCATGATCTACAAACTAAAATTGCCACATGACAACTTTAGTTTAAGCACCATGGCAAATACAGTGTAAACATCATGGCAACTTTTGGGCAAATTTTTTTCTCGTCGAAACATATCAACATGGGGTCTAGTTTTGAAGATCTCGTCGAGATGGATTTAATGGTGAAAACGGATTTTTAATTCGCTTTTTTAATTAGGAGATAAAACATTTTTAAGTCAAAAACCAAAAAGATTTCTGCTGATGTCATCTGTTTATACGTGGCAAAATGAGTGATGATGGAGGTGTGTGGGCTATGAGCAAACGCCCACACGTGTGGGCGTTAGTTTTTCCGTTCTATTTTCTATTTTTACGCGCCATTGTTTGCTTGTGGAAACGTCAAAGCTAGGTTTCAAACCAGTGTGCAGTCCTTGTAACAGTTTTTGACCTTGACAAACTTGTTCTTCACAACGAGTGTCGTTCGTAATGTTTCAGTTACTAAACAGTGGTCGTGCTGGCAACTCTTTACATCATTTGCAGTTTTCCTTCTTCTGTCCTGATAGCTTTCTGAAATAGTTCTGGTTCCAGTAAGTTTTCTTCTGAATGTTTCAATTTTTTTGGTATGTGCAGTAGGCGATCTTCACTACCGCGGCAACTATTACCCTCTCCATCATTCTGATATCT
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01