Query (optional)   in Class  

GrainGenes Probe Report: BE352587-D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE352587-D
Data at Wheat_SNP
BE352587-D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>A;DEL;T>G;T>C at 300;378;417-428;615;635
Reference sequence CCTCGTAAGAATCCCTTACCATCCACGCAAACTTCAGTTCAGTTTTCAAATTCTGCATCTGGCAAATCAAACATGTTTCGGTTGCAGATTTCTTTTAGGTTTCTTGTGTCCATTGCTTTGGTACTATGCAACGACTCTTTACTGCTGCAAGTACTACAATAGGGATCCCCGAGAGCGCCCGGGTCTTGCTGCCTCTGCTATTGCGGTAGGTTGTCCTTCCACAGTAAATCCTGAGCATGTTGCTATAATTAATGTAACTTGAAAGAAAACAACTCATAGATGCAAAGTAGTGTAATAGATAAACCATATCTAAGGTACAGAAAGCAAAAGAGTTTTCCTGTACAAAGTCATTTCTTCATGCATGTAAACCATCATGCGACCTGATTAGAAGATGTGTTGATGGTTCTGTCACCATATTGATTCACAGATTGATTATTTTTGTAGTCAAGGTGTGTTTTAATCCCGTTTGCTCTATCCTTTTATATGAAAATGCACATATGTGAAAACGAACCCCATCTGTATATTTTCTATTTTCTATTTTTATGTGCCATTGTTTGCATGTGGAAACATCAAAGCTAGGTTTCAAACCAGTGTGCAGTCCTTTTAACAGTTTTTTACCTTGACAAACTTGTTCTTCGCAGCAAGTGTTGTTCCTAATGTTTCAGTTACTAAACAGTGGTCGTGCTGGCAACTCTTTACATCATTTGCACTTTTTCTTCTTCTGTCCTGATAAGCTTTCTGAAATAGTTCTGGTTACAGCAAGTTTTCTTCTGAATGTTTCAATTTTTTTGGTATGTGCAGGCGGCCATCTTCACTACCGCGGCAACTATTACCCTCTCCATCATTCTGATTATCTGGGCACAAAAGTGATTTCTGAGGCAGGG
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01