Query (optional)   in Class  

GrainGenes Probe Report: BE398199-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE398199-7D
Data at Wheat_SNP
BE398199-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;G>A;T>C;G>T;C>T;T>C at 25;42;384;386;710;741
SNP C>T;T>C at 368;399
Reference sequence AAGACCAAGGGTGAGATTTTGTCAACTGAATGATTTGCAAAGCAGCCATGTGATGTGATGACCGATATATAATCTAGTCACATGATATCACTATTTTCAGCTTTGTGATCTGTATGAGAACGACTCAATATTTGACAAGTTTGAGTGTTGTCTTAGTGGGGATGGACTTCATGTTGCAACTGGCTCTTATGGGTAACCCCTTGTTCTTGTTATTGACTACATGTACAATGTTATTACAGTCCTGTTTGTTAATGCTTATATATTTAAAATGCTTGTGTCTTTAAATGCAGTAATCTATTCCGTGTTTTTGGTTCTACTCCTGGTAGCATGGAGGTGACCACTTTGGAAGCCAGCAGGAACCCGATGAGGTATGCTCGTTGAGCTTGAGATAACCTTTTATCATATCCTTTTTTTCCTTATCGGGAATTGAACCTGGATTGGATCAAACAAAACTCCTGGCAGGAGCAACTTTACCTTCTCCGTTCTGGAGCTAATAATACTCGGTGTATGATCTTTGTTTGGAAGCAACTCTTACAGATTGCTTCACTTTTCATTGTCATGCCTAGTCATGCAATTACTGTTTTATAATTTGTCTGAATTTTTGTTTCATTGTTGGATTTGGCTACCATGTAGACGTCAGATTGCAAACCCGACCAGACCCACTCGGGGGACGCTGACCTCTATGACCCGTGGTGTGCGAAGAGGTGAGCGTCTTTGTTTGAGCATTGACTCAGTATTTTTTGCAGTTCTTTTTTTTACCTAGTTTAATTGCTGAGACAATTTGTCTACAGGTGGGGAAAATCT
Reference sequence CTGGAAGCCAGCAGGAACCCGATGAGGTATGCTCGTTGAGCTTGAGATAACCTTTTATCATATCCTTTTTTTCCTTATCGGGAATTGAACCTGGATTGGATCAAACAAAACTCCTGGCAGGAGCAACTTTACCTTCTCCGTTCTGGAGCTAATAATACTCGGTGTATGATCTTTGTTTGGAAGCAACTCTTACAGATTGCTTCACTTTTCATTGTCATGCCTAGTCATGCAATTACTGTTTTATAATTTGTCTGAATTTTTGTTTCATTGTTGGATTTGGCTACCATGTAGACGTCAGATTGCAAACCCGACCAGACCCACTCGGGGGACGCTGACCTCTATGACCCGTGGTGTGCGAAGAGGTGAGCGTCTTTGTTTGAGCATTGACTCAGTATTTTTTGCAGTTCTTTTTTTTACCTAGTTTAATTGCTGAGACAATTTGTCTACAGGTGGGGAAAATCTAGGTGT
Type
EST
SNP
PCR primers
BE398199_cpR1 TCCATTGGCATCAACACCTA
BE398199D_F3 GGTGACCACTTTGGAAGCC
Sequence
NSFT03P2_Contig12918
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01