Query (optional)   in Class  

GrainGenes Probe Report: BE398523-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE398523-4A
Data at Wheat_SNP
BE398523-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G at 543
SNP DEL at 26
SNP T>G;C>T at 543;801
Reference sequence GACTTTGGCCACACCGTGCATGCCAACCATCTCCCACGTGGTGATGCAGCAGTGGAGAGGCCATTGGTTAGGCTATTCAAGCCATTTGATGAGCTCGTTGTTGACAGCAAGGTTACACTCTGCTCGCTCTGTGAACTAATCGTTACTCCCTCTGTTCATATTAGTTATTGCTGTTTTTGTACAATTTAGTCACAACTAATATGGAACAGAGGGGGTGTTTTTCTTTGTTCTTCTTACTTCATACAGATTACTGAGTATTAACATAGTGATGTGACATTTTGCAGGATTTTGATGTTTCTGCTTTGGAGAAATTCATTGATGCTAGCAGCACCCCGAAAGTTGTTACTTTTGACAAGAACCCTGACAACCATCCTTACCTCTTGAAATACTTCCAGAGCAATGCTCCCAAGGTAATGACTGACACAACTTGCTTCTAGAATGCTTTATCATTTTTCTTTATTGTATGAGTTCTGTATAGTTGACTAATTTCTACTATATGCTTAGTCAGTTAGGTCTATGCCTCATGTTTGTAACTAATGAGGCCATAATGTTTATCACTGTATGTTGTTTTGATAGACAGATGATTACTGCTGTATATTTTTGTTGATTATCAGCCCAACTCTTGGTGTGTACAAAAAACTTATGCAATCCAATGATGGTTGAATTTTCTTGAACATGTTGACATAAATGGTTGATTAGTATAATCTAGTCACGTTTTGGCGCAAGTCTTTGAATTGGGCAGTTAGTTCCTTCAACATTCATTCATCCTGTACATTGAAGAAATCATCTTGCAATGAATTTGTTCAGCGCATTTGGAGGATTACTAGTGTATTTAGCTTTGTTAGCCTTTTGGATCTTTGTGTTTTCTTTCATGGCTGTTGTACCTGAAAGGTCCTCTTCAGAACCATAGATGTAATGATTGTTTGAGAAGCACAATGCCATCTTTGGTGTTTTCAGTGCTTTGTGTGTAAAAACAGTTCAAATATATGCTTCCAGTGGTAAAGTTGCTTAGAGCATTAGCCTTTTCATTGTTTTTTAGTTATTGGTTACTCATTATTTGTCACTTCTGTTCTCTGACATCAAA
Reference sequence GTACATTTAGTCACAACTAATATGGAACAGAGGGGGTGTTTTTCTTTGTTCTTCTTACTTCATACATATTACTGAGTATTAACATAGTGATGTGACATTTTGCAGGATTTTGATGTTTCTGCTTTGGAGAAATTCATTGATGCTAGCAGCACCCCGAAAGTTGTTACTTTTGACAAGAACCCTGACAACCATCCTTACCTCTTGAAATACTTTCAGAGCAATGCTCCCAAGGTAATGACTGACACAACTTGCTTCTAGAATGCTTTATCATTTTTCTTTATTGTATGAGTTCTGTATAGTTGACTAATTTCTACTATATGCTTAGTCAGTTAGGTCTATGCCTCATGTTTGTAACTAATGAGGCCATAATGTTTATCACTGTATGTTGTTTTGATAGACAGATGATTACTGCTGTATATTTTTGTTGATTATCAGCCCAACTCTTGGTGTGTACAAAAAACTTATGCAATCCAATGATGGTTGAATTTTCTTGAACATGTTGACATAAATGGTTGATTAGTATAATCTAGTCACGTTTTGGCTCAAGTCTTTGAATTGGGCAGTTAGTTCCTTCGACATTCATTCATCCTGTACATTGAAGAAATCATCTTGCAATGAATTTGTTCAGCGCATTTGGAGGATTACTAGTGTATTTAGCTTTGTTAGCCTTTTGGATCTTTGTGTTTTCTTTCATGGCTGTTGTACCTGAAAGGTCCTCTTCAGAACCATAGATGTAATGATTGTTTGAGAAGCACAATGCCATCTTTGGTGTTTTCAGTGCTTTGTGTGTAAAAACAGTTCAAATATATGCTTCCAGTGGTAAAGTTGCTTAGAGCATTAGCCTTTTCATTGTTTTTT
Type
EST
SNP
PCR primers
BE398523A_F2 GCTCGCTCTGTGAACTAATCG
BE398523_cpR1 TTGAAGGACTCAAACGGTCC
Sequence
NSFT03P2_Contig18681
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01