Query (optional)   in Class  

GrainGenes Probe Report: BE398523-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE398523-4B
Data at Wheat_SNP
BE398523-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;C>G;A>T;T>G;G>C;T>C;T>C at 26;43;507;510;512;514;525
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE398523B_F1 GACAGCAAGGTTATACTTTGCTCC
BE398523_cpR1 TTGAAGGACTCAAACGGTCC
Sequence
NSFT03P2_Contig18681
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01