Query (optional)   in Class  

GrainGenes Probe Report: BE399426-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE399426-2B
Data at Wheat_SNP
BE399426-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 124
SNP T>C;A>G;C>T;C>T at 36;124;201;201
SNP A>G;C>T;C>T at 124;201;201
SNP A>G at 124
Reference sequence TACGTCATCCGGACTGGACTACGCAACATCAGCATTTCATACTCGCGGATCTCCCTTGCTGATATTGCGAAGAAGCTAAGGCTAGACACTGAGAATCCTGTTGCTGATGCGGAGTGCATCGTAACCAAGGCCATAAGAGATGGTGCAATTGATGCCACCATAGACCATGCAAATGGCTGGATGGTGTCGAAAGAAACTGGCGATGTCTACTCGACAAATGAACCCCAGGCTGCATTCAACTCCAGAATCGCTTTCTGCCTCAACATGCATAATGAAGCGGTCAAGGCCATGAGGTTCCCCCCGAATTCTCACAAGGAAAA
Type
EST
SNP
PCR primers
BE399426_cpR1 TTTCCTTGTGAGAATTCGGG
BE399426D_F4 ACGTCATCCGGACTGGACTA
Sequence
NSFT03P2_Contig14337
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01