Query (optional)   in Class  

GrainGenes Probe Report: BE399999-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE399999-1A
Data at Wheat_SNP
BE399999-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 165
SNP T>C at 184
Reference sequence ATGAAGCAGCCTGGCGGTCCACCCCTCAATCTCCTTGACACCAACATCAAAGCGGGGACTGATGACTCCACACTTGTTCAGTCTCCCGTTCAACTCCACAACAATCTTGCCAGATCTGTGGTCATCAACATACTCAAACTCACCAATGTAACCTGCAGAAAAAAAAGGCAGTGAGTAATCCATGCTATGGGATAGTTGCATATAGAACATGGCAGAAATGGAACTAACCGTGCTTCTGCATGACGATGAGGAACTTGATGATCACCTTTGAGGAGGGCCTGATCATGACCTGCCTCTTGCCACGCTTCTCAGCGTTGTACATGCTCTTGAGAGCATCGTTCAGGA
Reference sequence AAGCACGGTTTNTTCCATTCCTGCCATGTTCTATATGCAACTATCCCATAGCATGGATTACTCACTGCCTCTTTTTTCTGCAGGTTACATTGGTGAGTTTGAGTATGTTGATGACCACAGATCTGGCAAGATTGTTGTGGAGTTGAACGGGAGACTGAACAAGTGTGGAGTCATCAGTCCCCGTTTTGATGTTGGTGTCAAGGAGATTGAGGGGTGGACCGCCAGGCTGCTTCCAATCTCGTCAG
Type
EST
SNP
PCR primers
BE399999A_R2 AAGCACGGTTAGTTCCATTCCT
BE399999_cpF1 CTGACGAGATGGAAGCAGC
Sequence
NSFT03P2_Contig12695
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01