Query (optional)   in Class  

GrainGenes Probe Report: BE403152-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403152-6B
Data at Wheat_SNP
BE403152-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G at 256
Reference sequence CCCCCTACAGAGTGCAAACGCAGATCACCTGCTTGTTATGTAAAAAAAGTATTGATTTGCAATTTCACTGATGATGGCTGTTGACTGTAGGAAATTAATGGCCTCCACGGTAAAGGTGTTTCCGTTGAGAATATCTCTTCTCAACTTTCTCCTTGGGCATCTGCGCTATTTGAGTTTTTGCCCCAATTTATTAGGCAGCAGGTATGCATTGTCTCAGTTAATTCACAGAATCCCACAATTGACATCAGGTTTCTGTTGCTTCAACATAGTTATTTTTTATAATGCAGCTGCTTCTCCGTCCTGAATCTGATGACTCAGCTCAACTTTCTCAGGTACTGTAACACATGAAATCATCTTTCGATTATTGATGTAAAGTTGATATTTTTTCTTTTATCCTTTATTTTTGCTGATTTTAACATGTTCATCTGTGCAGATTGAAACCGAAAAGCTTCTAGCTCAATTGGTTGAGACCGAAATGAACAAACGTTTGGTATGCATTTTCTGTGGATTTGCTCACAACTGCCAGTTTAATTGGATGTCCAGTTTTGGTGCCACAAGCAATGGTTCTGTGAGCTCATAATGTGTTTCCCTTGTAATCTTGCAGAAGGAAGGCACTTACAAAGGAAAGAAGTTCAATGCAATCTG
Type
EST
SNP
PCR primers
BE403152B_F2_UCD TAAATAACAGTTTCCCCCCTACAGAG
BE403152_cpR1_UCD GCCAAAGAAGTGACAGATTGC
Sequence
NSFT03P2_Contig16816
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01