Query (optional)   in Class  

GrainGenes Probe Report: BE403378-5,4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403378-5,4D
Data at Wheat_SNP
BE403378-5,4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 13
Reference sequence TCTTAGTGCTTTCCGCGCACATGAGACTTCCAGACCCATCTACTCCTAACTTGAAGGTCTATCTAAAGAGACATAAAAGTTCCTTCCATTCTCCTAATTTCAGACAATATCTGACTCTTGTTTCTGTGGCAGATTGATCTGCTAGCTGAAATTTCATTACCTCCACGAATCATGTCAGATGTCGATGGTGCCCTCAAGTTAAAGCATATGAAGGTTGATGTCGATGAGTATCTTAAGGTGATGGCATTTATATATGCTGAATGAATTGCTTGTGTTGTCTGGGACCCTCATTTTACAGCGTTGTTGAATCTTCACTTGTATTGTGCAGAGACCAGAAGGCTCATCCTTTTTGAATGATCTGAAGCAAAAATTGCTGCTGCCTCAGAATGAAGCTAATGTTGCTGGGACACGCTACAATGTG
Type
EST
SNP
Sequence
NSFT03P2_Contig13567
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01