Query (optional)   in Class  

GrainGenes Probe Report: BE403631-A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403631-A
Data at Wheat_SNP
BE403631-A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;INS;G>A at 8,1;32,1;741
Reference sequence GCTTTGTTCCTTAATGCAGTCCTAAGAAACCATTGCTTTAAGCGCTGTTATATTGGGTTTGGTTATGGTTGGAAGAGCAGCATTCGTATTCCCTTTATCTTTTCTATCGAACTTAAGTAAAAAAGAGTCACATCCAAAGATTTCCTTCAACCAACAGGTTAGTATTTATCATTTTTTACCGATTTATTCATCTATTTTTGTGCTTCTGTCATTCTGCTCCTTATAGAGGGAGCTAACTTTGCTGGTGTTTTTCTCTAGGTTATCATATGGTGGGCAGGTCTCATGAGAGGAGCAGTTTCAATTGCACTTGCTTATAACAAGGTGATGTTTGACAGTAACAAATATGAACTGAACAGTTAAATCTAATGAATTGATTTGGAACTAGTACATGATGTGTTGGTAAGCCATCCTTGATATATAGAGGTTCTGATATAGAATTTTATTTTTTGTAAACCTTTGCAGTTTACAACATCTGGTCATACTGCTGTGCGAGTTAATGCTGTCATGATCACCAGCACAATCATTGTTGTTCTGTTCAGCACAATGGTAAGACTACTATCCCTTGCTGCCTTCATCATTATTCAATGACTATCTTATGGCCAGCATGGATGTTTCTTAGTTATTTATCAACAAAATACACACTAAAGTTTATGTTATGCTTTCTTCAGACATCATAATGCTGTTTGTTTCCTTATATAGAAACTTATAAATTGGTTGAGAGGTCAATCGCTAATACAGCTGTCTTATAAAGACTATTTTGCTTCCCTCAAGGAAACAGGAAATGACTTTCCTTTTGATTATATATTTGATCCAGGTTTTCGGCTTGCTGACTAAGCCTCTGATTAATCTCCTCATC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01