Query (optional)   in Class  

GrainGenes Probe Report: BE403637-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403637-3B
Data at Wheat_SNP
BE403637-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>G;C>T;G>A;A>C at 128;233;281;323;683
Reference sequence AGTCTGATCCTATGGTTCTCTGCACCATTGAAGAGTCTGGTGAGCATATCATTGCTGGAGCTGGAGAGCTTCATCTTGAAATCTGTCTGAAGGATCTGCAGGATGACTTCATGGGTGGTGCTGAAATCATTGTTTCCCCTCCTGTCGTCTCCTTCCGTGAGACTGTTCTGGAGAAGTCCTGCCGCACTGTCATGAGCAAGTCCCCCAACAAGCATAACCGTCTTTACATGGAAGCTCGCCCATTGGAGGAGGGATTGGCTGAGGCTATTGATGATGGCCGCATTGGCCCACGTGATGACCCTAAGGTGCGCTCCAAGATCCTGTCTGAGGAGTTTGGTTGGGACAAGGATCTCGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGCCCCAACATGGTTGTTGATATGTGTAAGGGAGTGCAGTATCTGAATGAAATCAAGGACTCTGTTGTGGCTGGGTTCCAGTGGGCATCAAAGGAAGGAGCATTGTGTGAGGAGAACATGCGTGGTATCTGCTATGAGGTCTGTGATGTTGTTCTCCACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATCCCAACGGCGAGGAGGGTCATTTACGCTTCTCAGCTCACCGCCAAGCCAAGGCTGCTGGAGCCCGTGTACCTGGTTGAGATCCAGGCCCCGGAGAACGCACTTGGTGGTATCTATGGTGTGCTGAATCAG
Type
EST
SNP
Sequence
NSFT03P2_Contig16163
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01