Query (optional)   in Class  

GrainGenes Probe Report: BE403637-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403637-4A
Data at Wheat_SNP
BE403637-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>A;A>G;A>T;A>T;A>G;T>G;G>C;C>T at 371;401;419;428;431;434;435;436;452
SNP G>T at 404
SNP T>C at 233
Reference sequence CCGGAGAGCTTCATCTTGAAATCTGCTTGAAGGATCTGCAGGATGACTTCATGGGTGGTGCTGAAATCATTGTTTCCCCCCCTGTCGTCTCCTTCCGTGAGACTGTTCTGGAGAAGTCCTGCCGTACCGTTATGAGCAAGTCCCCCAACAAGCATAACCGTCTTTACATGGAAGCTCGCCCATTGGAGGAGGGATTGGCTGAGGCTATTGATGATGGCCGCATTGGCCCGCGTGATGATCCTAAGGTGCGCTCCAAGATCCTGTCTGAGGAGTTTGGTTGGGACAAGGATCTCGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGCCCCAACATGGTTGTGGACATGTGTAAGGGAGTGCAGTACCTGAATGAAATCAAGGACTCTGTTGTGGCTGGGTTCCAGTGGGCATCAAAAGAAGGAGCACTATGTGAGGAGAACATGCGCGGCATCTGCTATGAGGTCTGTGATGTTGTTCTCCACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATCCCAACGGCGAGGAGGGTCATTTACGCTTCTCAGCTCACTGCCAAGCCAAGGCTGCTGGAGCCCGTGTACCTGGTTGAGATCCAGGCCCCGGAGAACGCACTTGGTGGTATCTATGGTGTGCTGAATCAAGAAAAGG
Type
EST
SNP
PCR primers
BE403637_cpR1_UCW CGTGGCCTCTCTTCTGATTC
Sequence
NSFT03P2_Contig16163
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01