Query (optional)   in Class  

GrainGenes Probe Report: BE403710-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403710-5B
Data at Wheat_SNP
BE403710-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 165
SNP T>C at 475
SNP A>G;G>A;G>A;A>G;G>C;G>C;C>G;A>T;G>A;T>A at 82;130;132;144;148;182;215;223;235;465
SNP C>A at 133
Reference sequence TGGACAAGGATGCAGTTATAATTGGATCTCCGGTAATATAGCTCACCGCTCTTTGCACATAATAATTTGCATCCTGTTACTATTTTGAATTGTATGCTTATGACATGATGCACATGCCCATGATATCTTGTGCTGTCATGTTGATTAGAATTTCCTCTAAATGAAAAACTATATATGTAATGTTCTTATATGCTTTACAAAATGATGTTTTCTTCAAGTGGTAACCGAACAAATGGTGGTAAATTCCAACTTTATTGATTGAAAATACTGTATCTGCAGCACTCATCTGATTGGCCTGTTATAGACCCTCTTCCATCCTATGGGCGCGGTAGAGAGCTCCCCGGAGGAAGGCACCAGAGCTTAATTTTTGGCTCCCATTTGACAGATGTAATAATTACTGGTTAGTAGCTAACTTGTGTCTATGTTGCATCAGCGACCTTTTATTATTATGCTGGTTTTGCAAGTGTTTAAATGTGGCACTCTTGGTAGGTGCTAATGGGACAATTGATGGTCAAGGAGCCATTTGGTGGGATTGGTTCCATAACAACACACTGAACTATACTAGGCCACATCT
Type
EST
SNP
PCR primers
BE403710B_F2 ATCTCACCTTATCATTGGACAAG
BE403710_cpR2 CATCAACTCGACAAGATGTGG
Sequence
NSFT03P2_Contig17414
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01