Query (optional)   in Class  

GrainGenes Probe Report: BE403740-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403740-7D
Data at Wheat_SNP
BE403740-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;G>T;G>T;A>G;A>T;G>C;C>T;T>A;G>C;A>T;A>T at 44;46;49;282;343;347;356;357;415;525;531
Reference sequence CTCTTCCGAGTTGCTGGACTCCATTTTGGATTCTGCAAGTGATGAGACGATTCAATGGAATGATTAGGGGTATGCTACTGATCCCTTTAGGTTAAATGAACCACTATCACATTAGATTTTAGATAACCCTCCCCAGCATGAATATGTAAATGACGTCGTCACACCATGATAAAATGCACAAAATGTATGCATGTAATGTGTGCCGCTGTGCCTTATACTCCCTCCCTCCAGAATTACTTGTCGTTCAAATGGGTGTATCTAGTATTAAAATACGTCTAGATACATCCATTTGAGCGACAAGTAATTTTGGATGGAGGTAGTATTTTGGTTGCTAGCTTGAACATGAGCTCTCTACCTAATCTTGCAAGATAAACAGACAGCGGTCCAAGGTGCATTATAGTTTAATGTAAAATAGACTTTTTTGCCCAACTTTGCAATACATAGATGACACCAGGGTCTAATTAGTTTATTATTTCTGATTTAATGTTCCAAAAAGTTAATAGACTATCTCAAAGCTTAAATAGAAGAACAAGATTAGGTACAAGCTATCCTACATTATGGGATTTAAGACAAATTTCAATTTATATGTGGAGAGAGCAGTCATTGCAGTTCCTACTTTAAAATATTGCCATTGCATAACAGACCAGGGGTCTACAGCTATCTGTATGCCAAA
Type
EST
SNP
Sequence
NSFT03P2_Contig17458
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01