Query (optional)   in Class  

GrainGenes Probe Report: BE403867-2,4,1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403867-2,4,1D
Data at Wheat_SNP
BE403867-2,4,1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;C>T;A>C;G>A;A>C;C>T;T>A;G>C;C>G at 31;45;46;48;55;58;60;153;234
Reference sequence TCTGTTCTATGACACCGGAAATGACCCTGAGGGTGGTTACTATGCAAGGTACCTATGCTTCTAAAGTATGGCCAATCTGAACTCTTCCTCATGGTTTGGTTCCATTTATTTACTCACTTCAGTGGTGTTGTTGTACAGAGGTGCGCGAGCTTGCCTGTGGGAGAACTTCAAGAACAATCCTCTGTTTGACATTTCCACCGATCACCCTGCGACTTACTACGAAGACATGCAGCCTGCTGTCTTCTGCCTGTGCCCATTGGGCTGGGCACCATGGAGCCCTAGGTTGGTTGAGGCTGTGGTCTTTGGCTGCATTCCAGTCATCATAGCTGACGATATTGTGCTGCCATTTGCTGATG
Type
EST
SNP
Sequence
NSFT03P2_Contig16110
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01