Query (optional)   in Class  

GrainGenes Probe Report: BE403950

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BE403950
Locus
Sr13
XBE403950
Reference
ReferenceSimons K et al. (2010) Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.) Theoretical and Applied Genetics 122:649-658.
ReferenceZhang W and Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr13 MAS Wheat. Marker Assisted Selection in Wheat.
Type
EST
PCR
PCR primers
BE403950-F GGAACATGTTGACGCTGTTG
BE403950-R AACACTGTTCCCGAAGTTGG
Amplification Conditions
Touch down from 60C to 55C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.