GrainGenes Probe Report: BE403950
[Submit comment/correction] [What is a probe?]
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
| |
| |
|  | Simons K et al. (2010) Genetic mapping of stem rust resistance gene Sr13 in tetraploid wheat (Triticum turgidum ssp. durum L.) Theoretical and Applied Genetics 122:649-658. |
|  | Zhang W and Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr13 MAS Wheat. Marker Assisted Selection in Wheat. |
|
|
| |
| BE403950-F GGAACATGTTGACGCTGTTG BE403950-R AACACTGTTCCCGAAGTTGG |
|
| Touch down from 60C to 55C |
|