Query (optional)   in Class  

GrainGenes Probe Report: BE403956-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403956-1B
Data at Wheat_SNP
BE403956-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;T>G at 836;898
[ Show all 10 ]
Type
EST
SNP
PCR primers
BE403956B_F2 CATAGTAATGTATCTGTGGTGTG
BE403956_cpR1 TCAGCTGTACTGCACGAAGG
Sequence
NSFT03P2_Contig17433
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01