Query (optional)   in Class  

GrainGenes Probe Report: BE403956-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE403956-1D
Data at Wheat_SNP
BE403956-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>C;G>A;A>G at 60;104;177;427
[ Show all 10 ]
Type
EST
SNP
PCR primers
BE403956_cpF1 AAGCACACCAACCAGTACCC
BE403956D_R3 AATTCATCACAAGATCGTACTTCG
Sequence
NSFT03P2_Contig17433
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01