Query (optional)   in Class  

GrainGenes Probe Report: BE404374-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404374-3A
Data at Wheat_SNP
BE404374-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 234
SNP C>T;C>T at 234;612
Reference sequence CAGGCGAAGATAGCAGCTGGCAAACTCGAGCTTGAGGCAGTGCCCTTTGATCTTAGACTAGTCTGTGATGACATCTTGTCTCTCTTCTGTGGAAAAGCTCAGGAGAAAGGACTGGAGGTAATTCCAGAGTAGATTCTTGCAGTGCAGTTTTGGTGTATTTTGTTGGAATGCACTAACCATTTTCATTTTTCATGATTTTATCTTTACGTGCTACGTGAGCAGTTGGCAGTGTACGTCTCTGATCAAGTTCCACAAACACTTATTGGCGATCCGGGTAGAATGAGGCAAATCATTACAAATCTCATGGGGAACTCCATAAAAGTAAGATGATTAATATACGTGAATAGTGCAAATAGAAATACAAAGCATGTTGTTATGAATGTTCATTATTTATATGTGTTCTGTTACTTGTTGGCTGAAGATTTCTATCTTTTTTTCACAGTTTACAGAAAGAGGGCATATCTACTTGACAGTTCATGTCGTCGAAGAGGTCATGAGTTGTTTAGAGGTGGAAACAGAATTTCAAAACACAAACAACACCTACAACACCTTAAGTGGCTACCAGGTAGCTAACAGAAGGCAGAGTTGGCAGAGCTTCCAACTTTTCAATACGGATTTACACTTGTCTGAGATGACCTTTGCTCCCATCATGCCTGAAACAATAAGATTGATAATATCTGTTGAAGATACCGGCGTCGGCATCCCACCTGAAGCCCAATCCCGGATATTCATGCCTTTCATGCAGGTTGGTCCATCCTGG
Reference sequence TGGCTACAGTTTCACATGAGATCAGAACTCCAATGAATGGGGTTTTAGGTAAGTGTGTGATTGATCTAATCCATAATGTATACTCCATTATTTTCTGACTGAAGGGATTTAAGCAATCGCCACTTTTTTCAGGAATGCTCCAAATGCTCATGGATACTGATCTGGACGCAACGCAGCAAGACTATGTTAGAACAGCCCAAGCCAGCGGAAAAGCTTTAGTGTCCCTCATAAATGAGGTTCTTGATCAGGCGAAGATAGAAGCTGGCAAACTCGAGCTTGAAAA
Type
EST
SNP
PCR primers
BE404374A_F1 GAGGTTCTTGATCAGGCGAAGATAGCAG
BE404374_cpR3 gatgcgggcaatggatggac
Sequence
WHE0441_D11_G21ZS
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01