Query (optional)   in Class  

GrainGenes Probe Report: BE404374-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404374-3D
Data at Wheat_SNP
BE404374-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;C>A;C>A;C>T at 400;423;423;445
SNP C>T;T>A;T>A;DEL;C>T at 459;479;480;481-483;504
SNP C>T;C>T at 400;445
Reference sequence CCGCGGAAAGGCTTTGTGTCCCTTATAAACGAGGTTCTTGATCAGGCGAAGATAGAATCTGGCAAACTCGAGCTTGAGGCAGTGCCCTTCGATCTTAGACTAGTCTGTGATGACATCTTGTCTCTCTTCTGTGGAAAAGCTCAGGAGAAAGGACTGGAGGTAATTCCAGAGTAGATTCTTGCAGTGCAGTTTTGGTGTATTTTGTTGGAATGCACTAACCATTTTCATTTTTCATGATTTTATCTTCACGTGCTACGCGAGCAGTTGGCAGTGTATGTCTCTGATCAAGTTCCACAAACACTTATTGGTGATCCGGGTAGAATGAGGCAAATCATTACAAATCTCATGGGGAACTCCATAAAAGTAAGATGATTAATATACGTGAATAGCGTAAAATAGAAATACAACGCATTTTGTTATAAATGTTCATTATTTATATGCGTTCTGTTATTTGTTGGCTGAAGATTTCTATTTTTTTTTTCACAGTTTACAGAAAGAGGACACATCTACTTGACAGTTCATGTCGTCGAAGAGGTCATGAGTTGTTTAGAGGTGGAAACAGAATTTCAAAACACAAACAACACCTACAACACCTTGAGTGGCTACAAGGTAGCTAACAGAAGGCATAGTTGGCAGAGCTTCCAGCTTTTCAATACGGATTTACACTCGGCTGAGATGCCCTTTGCTCCTATCCTGCCTGAAACAATAAGATTGATAATATCTGTTGAAGATACCGGCGTCGGCATCCCACCTGAAGCCCAATCCCGGATATTCTCGCCTTTCAGGCAGGT
Reference sequence TGGCAAACTCGAGCTTGAGGCAGTGCCCTTCGATCTTAGACTAGTCTGTGATGACATCTTGTCTCTCTTCTGTGGAAAAGCTCAGGAGAAAGGACTGGAGGTAATTCCAGAGTAGATTCTTGCAGTGCAGTTTTGGTGTATTTTGTTGGAATGCACTAACCATTTTCATTTTTCATGATTTTATCTTCACGTGCTACGCGAGCAGTTGGCAGTGTATGTCTCTGATCAAGTTCCACAAACACTTATTGGTGATCCGGGTAGAATGAGGCAAATCATTACAAATCTCATGGGGAACTCCATAAAAGTAAGATGATTAATATACGTGAATAGCGTAAAATAGAAATACAACGCATTTTGTTATAAATGTTCATTATTTATATGCGTTCTGTTATTTGTTGGCTGAAGATTTCTATTTTTTTTTTCACAGTTTACAGAAAGAGGACACATCTACTTGACAGTTCATGTCGTCGAAGAGGTCATGAGTTGTTTAGAGGTGGAAACAGAATTTCAAAACACAAACAACACCTACAACACCTTGAGTGGCTACAAGGTAGCTAACAGAAGGCATAGTTGGCAGAGCTTCCAGCTTTTCAATACGGATTTACACTCGGCTGAGATGCCCTTTGCTCCTATCCTGCCTGAAACAATAAGATTGATGATATCTGTTGAAGATACGGGCGTCGGCATCCC
Type
EST
SNP
PCR primers
BE404374_cpR3 gatgcgggcaatggatggac
BE404374D_F1 CAGCGGAAAGGCTTTAGTGTCCCTT
Sequence
WHE0441_D11_G21ZS
TC267397
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01