Query (optional)   in Class  

GrainGenes Probe Report: BE404580-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404580-2B
Data at Wheat_SNP
BE404580-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;T>C;T>C;C>A;G>A;C>T;T>C;C>G;G>A;T>A;T>G at 67;73;113;159;171;179;282;348;360;377;389
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE404580B_F2 AGCACTATGCCCCTGGAAG
BE404580B_F2 TCTGAACCAAACACCCCCTAAGT
BE404580_cpR1 CCATTGCCCCTCACATTATCBE474579-3A
PCR_primers
Sequence
NSFT03P2_Contig16343
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01