Query (optional)   in Class  

GrainGenes Probe Report: BE404580-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404580-3D
Data at Wheat_SNP
BE404580-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;DEL;G>A;G>A at 22;210-212;334;909
SNP C>T;C>T at 115;690
Reference sequence TGAGATCACCAAGAACAAACAATATATAGTCAAAGTCAGTGATACCAGGCTTGGAGGGATGGGTGGGGGAATGAAACCTCAGTAATGCTGACTTAAGCTCTGGAACAGAATGCAGACACTGCAGAGTGGAATTCATGTAACATGTATTCCCCAAGTTATAGAGACCAGCACTGTGCCCCTGGAAGTCACAAGAACAACCTTACTTGTAGCATAGATAGAGAACACCCAAAACCAAACCACCACGCTGGAGCTAAAGTCAAGAGATACTATTCTGATTGGTTTGATGCCAACATTTGGCAAAATCAAAAAATTGTAAAAATTTGGCAACTTCTTGTGAACCTGGCAAGAAAAGTTGGTAACCAACCAATTGCTAGCCAATATCTGGCATTTGCCAAATTTTGGATGCCAACTTTTGACATCAAACCTATCATGCTCTATATACAAATGATTTCATATAGAACTATAGAAGTTATACTTGGCTGCATATCGTACCACTCCCTGTTGAGACTGATTATATTCGTTCATGATCAGCATCTTAGTTACGTTAAACTGGCTATCCAAAAAAATATTATTGGTTCATGATCAGCAACTTAGTTACATTAAACAGGCTATCCAAGAAAGTTCAACAACAACAACAAAGCCTTTAGTCGCAAACAAGTTAGGGTAGGCTAGAGGTGAAATCCAAGAAAGTTCAAGAAAGATAAATTCATATTTAGCGCGAGTGTCCAATCTGATCCACAAGTTGGAGCATGTGTTCCAACTAATGTGTCTCCATGGCTAGCAGGAAACGTAACAGTATTTACTAAACACCGTAATTTGATCTATTTCTTTTCTTTCTTACTTTTTTGCAAGGGGTAGTTTGATCTATTTCTAATACATGAAAGAGCACCTGCAGAGTGCAGACATATGTTGTAAAGACAAAGTTGATTATGATTCGAATTAGTAACTTAAAAGGTACAGATTAAGGCCTAAAAAACAACATCACATATACGCATAGAACAAGAAGGCC
Reference sequence CATTGGTGTGTATGGCCTTCTTGGTTCTATGCGTATATGTGATGTTGTTTTTTAGGCCTTAATCTGTACCTTTTAAGTTACTAATTCGAATCATAATCAACTTTGTCTTTACAACATATGTCTGCACTCTGCAGGTGCTCTTTCATGTATTAGAAATAGATCAAACTACCCCTTGCAAAAAAGTAAGAAAGAAAAGAAATAGATCAAATTACGGTGTTTAGTAAATACTGTTACGTTTCCTGCTAGCCATGGAGACACATTAGTTGGAACACATGCTCCAACTTGTGGATCAGATTGGACACTCGCGCTAAATATGAATTTATCTTTCTTGAACTTTCTTGGATTTCACCTCTAGCCTACCCTAACTTGTTTGCGACTAAAGGCTTTGTTGTTGTTGTTGAACTTTCTTGGATAGCCTGTTTAATGTAACTAAGTTGCTGATCATGAACCAATAATATTTTTTTGGATAGCCAGTTTAACGTAACTAAGATGCTGATCATGAACGAATATAATCAGTCTCAACAGGGAGTGGTACGATATGCAGCCAAGTATAACTTCTATAGTTCTATATGAAATCATTTGTATATAGAGCATGATAGGTTTGATGTCAAAAGTTGGCATCCAAAATTTGGCAAATGCCAGATATTGGCTAGCAATTGGTTGGTTACCAACTTTTCTTGCCAGGTTCACAAGAAGTTGCCAAATTTTTACAATTTTTTGATTTTGCCAAATGTTGGCATCAAACCAATCAGAATAGTATCTCTTGACTTTAGCTCCAGCGTGGTGGTTTGGTTTTGGGTGTTCTCTATCTATGCTACAAGTAAGGTTGTTCTTGTGACTTCCAGGGGCACAGTGCTGGTCTCTATAACTTGGGGAATACATGTTACATGAATTCCACTCTGCAGTGTCTGCATTCTGTTCCAGAGCTTAAGTCAGCATTACTGAGGTTTCATTCCCCCACCCATCCCTCCAAGCCTGGTATCACTGACTTTGACCTATATATTGTTTGTTCCTTGGTGATCTC
Type
EST
SNP
Sequence
WHE0445_A01_A01ZS
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01