Query (optional)   in Class  

GrainGenes Probe Report: BE404728-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404728-7D
Data at Wheat_SNP
BE404728-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 101
SNP C>A;G>A at 140;300
Reference sequence ACATATTTGACGTTACGGATACCGCTATGCTCGATGGAACTCCTGAACATTCTTGCAAGGTATGCAAATACTACTTCCCAGTTGCCACAACAGCAACTGTTTCAGATTTTTAAAAATTAACCTATTTTTCCAAATACACCATTTTTTTTCTTTTTACGGATTCAAATACACAATCTTTTTTCCTTTTCCTTTATGAATTAAAACATTGGTTTACAGGTTGAGTATCAAGTCGAGGAATGCAGCGCAGAAAACCGAGCCAACAATGAGTGCATCCATACTAAGACTGCTAGAGCGGCCTTGCCGCGTGGAGGAGATATCGTGTTCAGTGTTGCGCACCAGCACTCCGGAGGAGTCGGTGCTTCTTTGCATGGCCAGGTAATAGATTAGCACCCTGATCGCTTTACCTATTGTGCTTATGCACTTCTCAGAGTTATTCTGAGGGGAAACACTCAATACTACCTATCTAAAACTTGGAATTGGGATTCCAGCTCCAATTCTGTCTGCAACCAAGCAGCTGATATTCACTGAGTTCAATTAATTCCTGAATACCATGCTCAGTTCTGCTAATCCAAACAGGGTATTACACGGTTTAAATGAGACCTTATATGTATATATGATGTCTAAATGGTAACATCACAACATGTTATTTGTGAAGGGAAGCCTAACTTCTAAGGTACATTGGACTTGCTACAGGACGGACGCCTTCTTTGTGAATCGCTTCCAACTTACGGCACGGGGAAGGAGGCAGGGAACGAGGCGAACTACATCGTTGGCATGTCGACGTG
Reference sequence AAAACATTGGTTTACAGGTTGAGTATCAAGTCGAGGAATGCAGCGCAGAAAACCGAGCCAACAATGAGTGCATCCATACTAAGACTGCTAGAGCGGCCTTGCCGCGTGGAGGAGATATCGTGTTCAGTGTTGCGCACCAGCACTCCGGAGGAGTCGGTGCTTCTTTGCATGGCCAGGTAATAGATTAGCACCCTGATCGCTTTACCTATTGTGCTTATGCACTTCTCAGAGTTATTCTGAGGGGAAACACTCAATACTACCTATCTAAAACTTGGAATTGGGATTCCAGCTCCAATTCTGTCTGCAACCAAGCAGCTGATATTCACTGAGTTCAATTAATTCCTGAATACCATGCTCAGTTCTGCTAATCCAAACAGGGTATTACACGGTTTAAATGAGACCTTATATGTATATATGATGTCTAAATGGTAACATCACAACATGTTATTTGTGAAGGGAAGCCTAACTTCTAAGGTACATTGGACTTGCTACAGGACGGACGCCTTCTTTGTGAATCGCTTCCAACTTACGGCACGGGGAAGGAGGCAGGGAACGAGGCGAACTACATCGTTGGCATGTCGACGTGCTACCCTAAGCC
Type
EST
SNP
PCR primers
BE404728_cpR1 TTGATGGATCCTGGCTTAGG
BE404728D_F2 TCCTTTATGAATTAAAACATTGGT
Sequence
NSFT03P2_Contig15820
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01