Query (optional)   in Class  

GrainGenes Probe Report: BE404886-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE404886-2B
Data at Wheat_SNP
BE404886-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>C;DEL;T>C;C>T;G>C;G>A;T>C;C>T;C>T;G>C;T>A;C>T;G>T;DEL;C>T;T>C;G>A;T>C;G>T;INS at 75;152;175-176;181;184;190;220;229;246;260;265;286;322;328;372;400;408;425;444;449;453,1
SNP at
SNP C>T at 368
Reference sequence TGCCGAGGGCATTAAAGAGGCCATCAAATCAGCCTTTGGATTAAGAACAAGGCGGGCTTTTTGGCTTGAAGATGAGGACGAGGTTGTTCGTTCCTTGGACAGGGACATGCCAGTCGGAGTATATGCTCTTCATCTTGATAATGGTAATTGTGAAATGTATTATTTTCCAAGAAATAAGATATTTTACTTTTCTTATCTTAATAAGAACCAAAAAGGACATAGTATAGTTCTATGGATCATTGATAAATTATTGTTCATTTTTCCTTCCTGACTTGATGAATTTTGCATCTATCTTGCATCATCTTGGTCACTGGTCAGTAATCGGTAAATCTTCTATGCATACTAATGGGCATTCATTTTGATGCTTCTAGTAATGATCATGATGGCCCCACTAAAATGAACCTATTCGGCAACCTGTGTTTGTATGCACATTGTTATTCAAATTGTCTCAATA
Reference sequence TGTCTTATCTTCTGTCCGGACTGTCATGCGGTCTGCATCTTCGAATGTGCAGAGTTTGATTGTTATCCCTGAAAATGAACATCTGGGGATGAGATTGGATCGACAACCTTCTGTAACCACTTCCTCCGTTCACAAATATAAGGTGTTCTAATTTTTTTGTGAATCGGATGTATATAGACATGTCTTAGTGTGTTTGTTCACTCATTTCAGTCCATATGTGGTCCATATTAAAATATCCAAAACATCTTATATTTGTGAACGGAGGGAGTACAATTTTTGTAATGGTGTTAAAAAGAACTTCAATAGTGATTAAACCAACAACTGCTTGGCTTCATACATATTGAGACAATTTCAATAACAATGTGCATACACAACACAGGTTGCCGAATAGGTTCATTTCAGTGGGGTCATCATGATCATTACTGGAAGCATCAAAATGAATGTCCATGAGTAGCATAGAAGATTTACCGATTACTGACCAGTGACCAAGATGATGCAAGATAGATGCAAGATAGATGCAAAATTCATCAAGTCGGGAAGGAAA
Type
EST
SNP
PCR primers
BE404886B_R1 TTGCTTCATACATATTGAGACAATTTG
BE404886_cpF1 CTGCCGAGGCAATTAAAGAG
Sequence
NSFT03P2_Contig9637
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01