Query (optional)   in Class  

GrainGenes Probe Report: BE405496-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE405496-3D
Data at Wheat_SNP
BE405496-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;DEL;G>A at 96;97-99;164
[ Show all 10 ]
Type
EST
SNP
PCR primers
BE405496_cpR1 ATTAGGGCCTTCAACTGGGT
BE405496D_F1 CAGCCTCAAAGCACCCCT
Sequence
DSW03C5_Contig5496.1
WHE1212_A04_B08ZS
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01