Query (optional)   in Class  

GrainGenes Probe Report: BE405518-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE405518-1A
Data at Wheat_SNP
BE405518-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C;A>G at 45;76;106
SNP T>C;A>G;T>A at 36;106;250
SNP T>C at 36
SNP at
Reference sequence GTCTCAAGGATTTGATACACTTTGGTCACCTCCATTGCAATACTCCAAATGGCTTGAAACGTTCATGTATCCCAGTACATGGGAGTTCTTATTTAATCTTTCGGTAATGGATATGTTTTGTTAGGCGTGAGAGAAGCTATTCACGGTCCCCATCTCCACGTCGTGGACGGGCCCGCAGTCGGAGCTACAGCAGAAGCCGTAGTTACAGGTATGCTGAGCAACCCACCCGCTACTCTTGGGCTTTTTACCTAGCAGTTTTGTTTTGTATTCTGTTTTCTCATATTTTCTCCTGCAATCAGCCGATCTAGGTCCAGATCTTATTCTGAATCTCCCAGAGGGCGCCGCACAGAGCGTGATGAGAGGAGATCAAGGAGGCATCA
Type
EST
SNP
Sequence
NSFT03P2_Contig17536
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01